Review



h3 cst 4620s  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Cell Signaling Technology Inc h3 cst 4620s
    H3 Cst 4620s, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 433 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/histone+h3+cst/Histone+H3+XP+Rabbit+mAb/pm41933932-202-73-74
    Average 96 stars, based on 433 article reviews
    h3 cst 4620s - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Western Blot:

    Article Title: Inhibitory Effect of Essential Oil from Fructus Alpiniae zerumbet on Endothelial-to-Mesenchymal Transformation Induced by TGF-β1 and down-regulating KLF4
    Article Snippet: .. Table 1 Specifc antibodies for Western blot Antibody Company Catalogue number Dilution VE-cadherin CST 2500 1:1000 α-SMA CST 19245 1:1000 Snail CST 3879 1:1000 KLF4 CST 4038 1:1000 Notch-1 CST 3608 1:1000 Notch-3 CST 5276 1:1000 Histone H3 CST 4499 1:1000 Acetyl-Histone H3 CST 9649 1:1000 p300 CST 86377 1:1000 HDAC2 Proteintech 12922-3-AP 1:1000 β-actin A nity Biosciences T0022 1:7000 GAPDH Bioworld MB001 1:10000 2.9 Quantitative real-time PCR analysis qRT-PCR Total RNA was extracted using TransZol Up Plus RNA Kit and reverse transcribed to cDNA followed by Real-time PCR reaction. ..

    Article Title: Inhibitory Effect of Essential Oil from Fructus Alpiniae zerumbet on Endothelial-to-Mesenchymal Transformation Induced by TGF-β1 and down-regulating KLF4
    Article Snippet: .. Tables Table 1 Specifc antibodies for Western blot Antibody Company Catalogue number Dilution VE-cadherin CST 2500 1:1000 α-SMA CST 19245 1:1000 Snail CST 3879 1:1000 KLF4 CST 4038 1:1000 Notch-1 CST 3608 1:1000 Notch-3 CST 5276 1:1000 Histone H3 CST 4499 1:1000 Acetyl-Histone H3 CST 9649 1:1000 p300 CST 86377 1:1000 HDAC2 Proteintech 12922-3-AP 1:1000 β-actin A nity Biosciences T0022 1:7000 GAPDH Bioworld MB001 1:10000 Table 2 Specifc primers for quantitative RT-PCR Page 18/26 Gene Forward Reverse VE-cadherin CAAGGACACTGGCGAAA ACGCATTGAACAACCGA α-SMA CGTGGCTATTCCTTCGTT ACGTTCATTTCCGATGGT Collagen GCCTCAACATCCCCTACA CAGCCCACGAAGAACAGA Snail ACATCCGAAGCCACACG TGGGGACAGGAGAAGGG KLF4 AGGAGCCCAGCCAGAAA TCCAGTCACAGACCCCATC Notch-1 AGGCTCTGCCGACATCA AGGAAGGGGTGCTCTGG Notch-3 GCTGTTCCCCTTGACTGG CTTTGTGGGGCTGCTGT β-actin GACATGCCGCCTGGAGAAAC AGCCCAGGATGCCCTTTAGT Figures Figure 1 Effect of TGF-β1 stimulation on the expression of EndMT markers. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Inhibitory Effect of Essential Oil from Fructus Alpiniae zerumbet on Endothelial-to-Mesenchymal Transformation Induced by TGF-β1 and down-regulating KLF4
    Article Snippet: .. Table 1 Specifc antibodies for Western blot Antibody Company Catalogue number Dilution VE-cadherin CST 2500 1:1000 α-SMA CST 19245 1:1000 Snail CST 3879 1:1000 KLF4 CST 4038 1:1000 Notch-1 CST 3608 1:1000 Notch-3 CST 5276 1:1000 Histone H3 CST 4499 1:1000 Acetyl-Histone H3 CST 9649 1:1000 p300 CST 86377 1:1000 HDAC2 Proteintech 12922-3-AP 1:1000 β-actin A nity Biosciences T0022 1:7000 GAPDH Bioworld MB001 1:10000 2.9 Quantitative real-time PCR analysis qRT-PCR Total RNA was extracted using TransZol Up Plus RNA Kit and reverse transcribed to cDNA followed by Real-time PCR reaction. ..

    Quantitative RT-PCR:

    Article Title: Inhibitory Effect of Essential Oil from Fructus Alpiniae zerumbet on Endothelial-to-Mesenchymal Transformation Induced by TGF-β1 and down-regulating KLF4
    Article Snippet: .. Table 1 Specifc antibodies for Western blot Antibody Company Catalogue number Dilution VE-cadherin CST 2500 1:1000 α-SMA CST 19245 1:1000 Snail CST 3879 1:1000 KLF4 CST 4038 1:1000 Notch-1 CST 3608 1:1000 Notch-3 CST 5276 1:1000 Histone H3 CST 4499 1:1000 Acetyl-Histone H3 CST 9649 1:1000 p300 CST 86377 1:1000 HDAC2 Proteintech 12922-3-AP 1:1000 β-actin A nity Biosciences T0022 1:7000 GAPDH Bioworld MB001 1:10000 2.9 Quantitative real-time PCR analysis qRT-PCR Total RNA was extracted using TransZol Up Plus RNA Kit and reverse transcribed to cDNA followed by Real-time PCR reaction. ..

    Article Title: Inhibitory Effect of Essential Oil from Fructus Alpiniae zerumbet on Endothelial-to-Mesenchymal Transformation Induced by TGF-β1 and down-regulating KLF4
    Article Snippet: .. Tables Table 1 Specifc antibodies for Western blot Antibody Company Catalogue number Dilution VE-cadherin CST 2500 1:1000 α-SMA CST 19245 1:1000 Snail CST 3879 1:1000 KLF4 CST 4038 1:1000 Notch-1 CST 3608 1:1000 Notch-3 CST 5276 1:1000 Histone H3 CST 4499 1:1000 Acetyl-Histone H3 CST 9649 1:1000 p300 CST 86377 1:1000 HDAC2 Proteintech 12922-3-AP 1:1000 β-actin A nity Biosciences T0022 1:7000 GAPDH Bioworld MB001 1:10000 Table 2 Specifc primers for quantitative RT-PCR Page 18/26 Gene Forward Reverse VE-cadherin CAAGGACACTGGCGAAA ACGCATTGAACAACCGA α-SMA CGTGGCTATTCCTTCGTT ACGTTCATTTCCGATGGT Collagen GCCTCAACATCCCCTACA CAGCCCACGAAGAACAGA Snail ACATCCGAAGCCACACG TGGGGACAGGAGAAGGG KLF4 AGGAGCCCAGCCAGAAA TCCAGTCACAGACCCCATC Notch-1 AGGCTCTGCCGACATCA AGGAAGGGGTGCTCTGG Notch-3 GCTGTTCCCCTTGACTGG CTTTGTGGGGCTGCTGT β-actin GACATGCCGCCTGGAGAAAC AGCCCAGGATGCCCTTTAGT Figures Figure 1 Effect of TGF-β1 stimulation on the expression of EndMT markers. ..

    Reverse Transcription:

    Article Title: Inhibitory Effect of Essential Oil from Fructus Alpiniae zerumbet on Endothelial-to-Mesenchymal Transformation Induced by TGF-β1 and down-regulating KLF4
    Article Snippet: .. Table 1 Specifc antibodies for Western blot Antibody Company Catalogue number Dilution VE-cadherin CST 2500 1:1000 α-SMA CST 19245 1:1000 Snail CST 3879 1:1000 KLF4 CST 4038 1:1000 Notch-1 CST 3608 1:1000 Notch-3 CST 5276 1:1000 Histone H3 CST 4499 1:1000 Acetyl-Histone H3 CST 9649 1:1000 p300 CST 86377 1:1000 HDAC2 Proteintech 12922-3-AP 1:1000 β-actin A nity Biosciences T0022 1:7000 GAPDH Bioworld MB001 1:10000 2.9 Quantitative real-time PCR analysis qRT-PCR Total RNA was extracted using TransZol Up Plus RNA Kit and reverse transcribed to cDNA followed by Real-time PCR reaction. ..

    Expressing:

    Article Title: Inhibitory Effect of Essential Oil from Fructus Alpiniae zerumbet on Endothelial-to-Mesenchymal Transformation Induced by TGF-β1 and down-regulating KLF4
    Article Snippet: .. Tables Table 1 Specifc antibodies for Western blot Antibody Company Catalogue number Dilution VE-cadherin CST 2500 1:1000 α-SMA CST 19245 1:1000 Snail CST 3879 1:1000 KLF4 CST 4038 1:1000 Notch-1 CST 3608 1:1000 Notch-3 CST 5276 1:1000 Histone H3 CST 4499 1:1000 Acetyl-Histone H3 CST 9649 1:1000 p300 CST 86377 1:1000 HDAC2 Proteintech 12922-3-AP 1:1000 β-actin A nity Biosciences T0022 1:7000 GAPDH Bioworld MB001 1:10000 Table 2 Specifc primers for quantitative RT-PCR Page 18/26 Gene Forward Reverse VE-cadherin CAAGGACACTGGCGAAA ACGCATTGAACAACCGA α-SMA CGTGGCTATTCCTTCGTT ACGTTCATTTCCGATGGT Collagen GCCTCAACATCCCCTACA CAGCCCACGAAGAACAGA Snail ACATCCGAAGCCACACG TGGGGACAGGAGAAGGG KLF4 AGGAGCCCAGCCAGAAA TCCAGTCACAGACCCCATC Notch-1 AGGCTCTGCCGACATCA AGGAAGGGGTGCTCTGG Notch-3 GCTGTTCCCCTTGACTGG CTTTGTGGGGCTGCTGT β-actin GACATGCCGCCTGGAGAAAC AGCCCAGGATGCCCTTTAGT Figures Figure 1 Effect of TGF-β1 stimulation on the expression of EndMT markers. ..



    Similar Products

    96
    Cell Signaling Technology Inc h3 cst 4620s
    H3 Cst 4620s, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/histone+h3+cst/Histone+H3+XP+Rabbit+mAb/pm41933932-202-73-74
    Average 96 stars, based on 1 article reviews
    h3 cst 4620s - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    97
    Cell Signaling Technology Inc h3k27ac cst 8173s
    H3k27ac Cst 8173s, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/histone+h3+cst/Acetyl-Histone+H3+(Lys27)+XP+Rabbit+mAb/pm41904157-540-18-19
    Average 97 stars, based on 1 article reviews
    h3k27ac cst 8173s - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Cell Signaling Technology Inc h3 cst 9715
    H3 Cst 9715, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/histone+h3+cst/Histone+H3+Antibody/pmc12992861-64-18-19
    Average 97 stars, based on 1 article reviews
    h3 cst 9715 - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Cell Signaling Technology Inc cst 9733
    Cst 9733, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/histone+h3+cst/Tri-Methyl-Histone+H3+(Lys27)+Rabbit+mAb/pm41821095-239-62-62
    Average 97 stars, based on 1 article reviews
    cst 9733 - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Cell Signaling Technology Inc h3k27ac cst
    H3k27ac Cst, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/histone+h3+cst/Acetyl-Histone+H3+(Lys27)+XP+Rabbit+mAb/pm41814168-87-21-22
    Average 97 stars, based on 1 article reviews
    h3k27ac cst - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc h3k9ac cst
    S100A11 knockdown alleviates microglial inflammation by inhibiting mitophagy through the TFEB/H3K27ac axis. A-B Western blot analysis of TFEB, TFEC, and TFE3 protein expression levels in the cytoplasm and nucleus of primary microglia, along with the corresponding detection and quantification plots ( D-F , for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). C Immunofluorescence staining of TFEB in primary microglia. G Western blot analysis of pink1, Parkin, P62, LC3II protein levels of primary microglia; H-K Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). M Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green). Quantification of the mean fluorescence intensity of LC3 is shown in panel L . and relative fluorescence intensity was quantified in panel L ( n = 3). N Western blot analysis of H4K16ac, H4K12ac, H3K27ac, H3K18ac, <t>H3K9ac</t> protein levels of microglia; O-S Relative levels normalized to histone H3 were quantified (for three independent experiments, statistical significance was determined by two-way ANOVA with appropriate post hoc tests). T Western blot analysis of Pink1, Parkin, P62, LC3II protein levels of primary microglia; U-X Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). Z Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green), and relative fluorescence intensity was quantified in panel Y ( n = 3). Scale bars as indicated. Data are presented as mean ± SEM. * P < 0.05 , ** P < 0.01 , *** P < 0.001
    H3k9ac Cst, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/histone+h3+cst/Acetyl-Histone+H3+(Lys9)+Rabbit+mAb/pmc12980994-96-90-91
    Average 96 stars, based on 1 article reviews
    h3k9ac cst - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    Cell Signaling Technology Inc h3k18ac cst
    S100A11 knockdown alleviates microglial inflammation by inhibiting mitophagy through the TFEB/H3K27ac axis. A-B Western blot analysis of TFEB, TFEC, and TFE3 protein expression levels in the cytoplasm and nucleus of primary microglia, along with the corresponding detection and quantification plots ( D-F , for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). C Immunofluorescence staining of TFEB in primary microglia. G Western blot analysis of pink1, Parkin, P62, LC3II protein levels of primary microglia; H-K Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). M Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green). Quantification of the mean fluorescence intensity of LC3 is shown in panel L . and relative fluorescence intensity was quantified in panel L ( n = 3). N Western blot analysis of H4K16ac, H4K12ac, H3K27ac, <t>H3K18ac,</t> H3K9ac protein levels of microglia; O-S Relative levels normalized to histone H3 were quantified (for three independent experiments, statistical significance was determined by two-way ANOVA with appropriate post hoc tests). T Western blot analysis of Pink1, Parkin, P62, LC3II protein levels of primary microglia; U-X Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). Z Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green), and relative fluorescence intensity was quantified in panel Y ( n = 3). Scale bars as indicated. Data are presented as mean ± SEM. * P < 0.05 , ** P < 0.01 , *** P < 0.001
    H3k18ac Cst, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/histone+h3+cst/Acetyl-Histone+H3+(Lys18)+Rabbit+mAb/pmc12980994-96-94-95
    Average 95 stars, based on 1 article reviews
    h3k18ac cst - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results


    S100A11 knockdown alleviates microglial inflammation by inhibiting mitophagy through the TFEB/H3K27ac axis. A-B Western blot analysis of TFEB, TFEC, and TFE3 protein expression levels in the cytoplasm and nucleus of primary microglia, along with the corresponding detection and quantification plots ( D-F , for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). C Immunofluorescence staining of TFEB in primary microglia. G Western blot analysis of pink1, Parkin, P62, LC3II protein levels of primary microglia; H-K Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). M Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green). Quantification of the mean fluorescence intensity of LC3 is shown in panel L . and relative fluorescence intensity was quantified in panel L ( n = 3). N Western blot analysis of H4K16ac, H4K12ac, H3K27ac, H3K18ac, H3K9ac protein levels of microglia; O-S Relative levels normalized to histone H3 were quantified (for three independent experiments, statistical significance was determined by two-way ANOVA with appropriate post hoc tests). T Western blot analysis of Pink1, Parkin, P62, LC3II protein levels of primary microglia; U-X Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). Z Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green), and relative fluorescence intensity was quantified in panel Y ( n = 3). Scale bars as indicated. Data are presented as mean ± SEM. * P < 0.05 , ** P < 0.01 , *** P < 0.001

    Journal: The Journal of Headache and Pain

    Article Title: S100A11 regulates microglial inflammatory response in neuropathic pain via H3K27ac-TFEB-mitochondrial autophagy axis

    doi: 10.1186/s10194-026-02328-9

    Figure Lengend Snippet: S100A11 knockdown alleviates microglial inflammation by inhibiting mitophagy through the TFEB/H3K27ac axis. A-B Western blot analysis of TFEB, TFEC, and TFE3 protein expression levels in the cytoplasm and nucleus of primary microglia, along with the corresponding detection and quantification plots ( D-F , for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). C Immunofluorescence staining of TFEB in primary microglia. G Western blot analysis of pink1, Parkin, P62, LC3II protein levels of primary microglia; H-K Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). M Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green). Quantification of the mean fluorescence intensity of LC3 is shown in panel L . and relative fluorescence intensity was quantified in panel L ( n = 3). N Western blot analysis of H4K16ac, H4K12ac, H3K27ac, H3K18ac, H3K9ac protein levels of microglia; O-S Relative levels normalized to histone H3 were quantified (for three independent experiments, statistical significance was determined by two-way ANOVA with appropriate post hoc tests). T Western blot analysis of Pink1, Parkin, P62, LC3II protein levels of primary microglia; U-X Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). Z Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green), and relative fluorescence intensity was quantified in panel Y ( n = 3). Scale bars as indicated. Data are presented as mean ± SEM. * P < 0.05 , ** P < 0.01 , *** P < 0.001

    Article Snippet: Membranes were blocked with 5% skim milk for 60 min, rinsed with TBST, and incubated with primary antibodies at 4 °C overnight (β-actin: Proteintech, 66009-1-Ig, 1:10000; S100A11: Abcam, ab169530, 1:1000; NLRP3: AdipoGen, AG-20B-0014, 1:1000; GSDMD-N: Abcam, ab215203, 1:1000; ASC: Wanleibio, WL02462, 1:500; Caspase1: CST, 89332, 1:1000; Bax: Proteintech, 50599-2-Ig, 1:2000; Bcl-2: abclone, A19693, 1:2000; COXIV: Proteintech, 11242-1-AP, 1:1000; LC3: Proteintech, 14600-1-AP, 1:2000; P62: Proteintech, 18420-1-AP, 1:2000; Parkin: Proteintech, 14060-1-AP, 1:1000; Pink1: Proteintech, 23274-1-AP, 1:2000; H3: Proteintech, 17168-1-AP, 1:2000; TFEB: Proteintech, 13372-1-AP, 1:1000; TFEC: Proteintech, 13547-1-AP, 1:1000; TFE3: Proteintech, 14480-1-AP, 1:1000; H3K9ac: CST, 9649, 1:1000; H3K18ac: CST, 13998, 1:1000; H3K27ac: CST, 8173, 1:1000; H4K12ac; CST, 13944, 1:1000; H4K16ac: CST, 13534, 1:1000).

    Techniques: Knockdown, Western Blot, Expressing, Immunofluorescence, Staining, Labeling, Fluorescence

    S100A11 knockdown alleviates microglial inflammation by inhibiting mitophagy through the TFEB/H3K27ac axis. A-B Western blot analysis of TFEB, TFEC, and TFE3 protein expression levels in the cytoplasm and nucleus of primary microglia, along with the corresponding detection and quantification plots ( D-F , for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). C Immunofluorescence staining of TFEB in primary microglia. G Western blot analysis of pink1, Parkin, P62, LC3II protein levels of primary microglia; H-K Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). M Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green). Quantification of the mean fluorescence intensity of LC3 is shown in panel L . and relative fluorescence intensity was quantified in panel L ( n = 3). N Western blot analysis of H4K16ac, H4K12ac, H3K27ac, H3K18ac, H3K9ac protein levels of microglia; O-S Relative levels normalized to histone H3 were quantified (for three independent experiments, statistical significance was determined by two-way ANOVA with appropriate post hoc tests). T Western blot analysis of Pink1, Parkin, P62, LC3II protein levels of primary microglia; U-X Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). Z Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green), and relative fluorescence intensity was quantified in panel Y ( n = 3). Scale bars as indicated. Data are presented as mean ± SEM. * P < 0.05 , ** P < 0.01 , *** P < 0.001

    Journal: The Journal of Headache and Pain

    Article Title: S100A11 regulates microglial inflammatory response in neuropathic pain via H3K27ac-TFEB-mitochondrial autophagy axis

    doi: 10.1186/s10194-026-02328-9

    Figure Lengend Snippet: S100A11 knockdown alleviates microglial inflammation by inhibiting mitophagy through the TFEB/H3K27ac axis. A-B Western blot analysis of TFEB, TFEC, and TFE3 protein expression levels in the cytoplasm and nucleus of primary microglia, along with the corresponding detection and quantification plots ( D-F , for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). C Immunofluorescence staining of TFEB in primary microglia. G Western blot analysis of pink1, Parkin, P62, LC3II protein levels of primary microglia; H-K Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). M Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green). Quantification of the mean fluorescence intensity of LC3 is shown in panel L . and relative fluorescence intensity was quantified in panel L ( n = 3). N Western blot analysis of H4K16ac, H4K12ac, H3K27ac, H3K18ac, H3K9ac protein levels of microglia; O-S Relative levels normalized to histone H3 were quantified (for three independent experiments, statistical significance was determined by two-way ANOVA with appropriate post hoc tests). T Western blot analysis of Pink1, Parkin, P62, LC3II protein levels of primary microglia; U-X Relative levels normalized to COX IV were quantified (for three independent experiments, statistical significance was determined by one-way ANOVA with appropriate post hoc tests). Z Labeling of mitochondria (red) in primary microglia with Tom20; immunofluorescence staining for LC3B (green), and relative fluorescence intensity was quantified in panel Y ( n = 3). Scale bars as indicated. Data are presented as mean ± SEM. * P < 0.05 , ** P < 0.01 , *** P < 0.001

    Article Snippet: Membranes were blocked with 5% skim milk for 60 min, rinsed with TBST, and incubated with primary antibodies at 4 °C overnight (β-actin: Proteintech, 66009-1-Ig, 1:10000; S100A11: Abcam, ab169530, 1:1000; NLRP3: AdipoGen, AG-20B-0014, 1:1000; GSDMD-N: Abcam, ab215203, 1:1000; ASC: Wanleibio, WL02462, 1:500; Caspase1: CST, 89332, 1:1000; Bax: Proteintech, 50599-2-Ig, 1:2000; Bcl-2: abclone, A19693, 1:2000; COXIV: Proteintech, 11242-1-AP, 1:1000; LC3: Proteintech, 14600-1-AP, 1:2000; P62: Proteintech, 18420-1-AP, 1:2000; Parkin: Proteintech, 14060-1-AP, 1:1000; Pink1: Proteintech, 23274-1-AP, 1:2000; H3: Proteintech, 17168-1-AP, 1:2000; TFEB: Proteintech, 13372-1-AP, 1:1000; TFEC: Proteintech, 13547-1-AP, 1:1000; TFE3: Proteintech, 14480-1-AP, 1:1000; H3K9ac: CST, 9649, 1:1000; H3K18ac: CST, 13998, 1:1000; H3K27ac: CST, 8173, 1:1000; H4K12ac; CST, 13944, 1:1000; H4K16ac: CST, 13534, 1:1000).

    Techniques: Knockdown, Western Blot, Expressing, Immunofluorescence, Staining, Labeling, Fluorescence